1.QC to bam

cd ./0_data/
ls

[0m[01;31mGFP_OE_250926N_R1.fastq.gz[0m  [01;31mrox2_OE_250926N_R1.fastq.gz[0m
[01;31mGFP_OE_250926N_R2.fastq.gz[0m  [01;31mrox2_OE_250926N_R2.fastq.gz[0m

for i in `ls *_R1.fastq.gz`
do
    prefix=${i%%_R1.fastq.gz}
    name=${i%%_25*}
    echo $name

    fastp -i $i -o ${name}_R1.fq.gz -I ${prefix}_R2.fastq.gz -O ${name}_R2.fq.gz -w 50  -j ${name}.json -h ${name}.html --detect_adapter_for_pe
    bowtie2 -t -q -p 50 --local --very-sensitive-local --no-mixed --no-discordant --no-unal --phred33 -X 2000 -x '/home/yhli/genome/dm6Bowtie2/dm6' -1 ${name}_R1.fq.gz -2 ${name}_R2.fq.gz -S ./${name}.sam
    samtools view -@ 50 -F 0x904 -q 20 -b -h -o ${name}.bam ${name}.sam 
	sambamba markdup -r -t 50 ${name}.bam ${name}.rmdup.bam
	samtools view -@ 50 -h ${name}.rmdup.bam | grep -v 'random'|grep -v 'chrUn'|grep -v 'chrM'|samtools view -@ 50 -bS -o ${name}.rmChr.bam
    samtools sort -@ 50 ${name}.rmChr.bam > ${name}.final.bam
	samtools index -@ 50 ${name}.final.bam

    total=`echo $(($(zcat ${i} | wc -l )/2))`
	map=`samtools view -@ 50 -c ${name}.bam`
	rmdup=`samtools view -@ 50 -c ${name}.rmdup.bam`
	final=`samtools view -@ 50 -c ${name}.final.bam`
	echo -e "${name} ${total} ${map} ${rmdup} ${final}" >> mapping.log

    rm ${name}.sam
    rm ${name}.bam
    rm ${name}.rmChr.bam
    rm ${name}.rmdup.bam
done

GFP_OE
Detecting adapter sequence for read1...
>I7_Nextera_Transposase_1 | >Trans2_rc | >I7_Nextera_Transposase_1 | >Trans2_rc
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

Detecting adapter sequence for read2...
>I5_Nextera_Transposase_1 | >Trans1_rc | >I5_Nextera_Transposase_1 | >Trans1_rc
CTGTCTCTTATACACATCTGACGCTGCCGACGA

WARNING: fastp uses up to 16 threads although you specified 50
Read1 before filtering:
total reads: 21437850
total bases: 3215677500
Q20 bases: 3041184237(94.5737%)
Q30 bases: 2824348619(87.8306%)

Read2 before filtering:
total reads: 21437850
total bases: 3215677500
Q20 bases: 3146664392(97.8539%)
Q30 bases: 2994646853(93.1265%)

Read1 after filtering:
total reads: 21182137
total bases: 2357310971
Q20 bases: 2339405695(99.2404%)
Q30 bases: 2267885738(96.2065%)

Read2 after filtering:
total reads: 21182137
total bases: 2357820595
Q20 bases: 2322471304(98.5008%)
Q30 bases: 2225144751(94.3729%)

Filtering result:
reads passed filter: 42364274
reads failed due to low quality: 489316
reads failed due to too many N: 21974
reads failed due to too short: 136
reads with adapter trimmed: 28099246
bases trimmed due to adapters: 1656753510

Duplication rate: 19.0219%

Insert size peak (evaluated by paired-end reads): 65

JSON report: GFP_OE.json
HTML report: GFP_OE.html

fastp -i GFP_OE_250926N_R1.fastq.gz -o GFP_OE_R1.fq.gz -I GFP_OE_250926N_R2.fastq.gz -O GFP_OE_R2.fq.gz -w 50 -j GFP_OE.json -h GFP_OE.html --detect_adapter_for_pe 
fastp v0.23.4, time used: 92 seconds
Time loading reference: 00:00:00
Time loading forward index: 00:00:00
Time loading mirror index: 00:00:00
Multiseed full-index search: 00:13:41
21182137 reads; of these:
  21182137 (100.00%) were paired; of these:
    8133888 (38.40%) aligned concordantly 0 times
    9453759 (44.63%) aligned concordantly exactly 1 time
    3594490 (16.97%) aligned concordantly >1 times
61.60% overall alignment rate
Time searching: 00:13:41
Overall time: 00:13:41

sambamba 1.0.1
 by Artem Tarasov and Pjotr Prins (C) 2012-2023
    LDC 1.38.0 / DMD v2.108.1 / LLVM17.0.6 / bootstrap LDC - the LLVM D compiler (1.38.0)

finding positions of the duplicate reads in the file...
  sorted 10099542 end pairs
     and 0 single ends (among them 0 unmatched pairs)
  collecting indices of duplicate reads...   done in 1156 ms
  found 4808164 duplicates
collected list of positions in 0 min 33 sec
removing duplicates...
collected list of positions in 1 min 3 sec
[bam_sort_core] merging from 0 files and 50 in-memory blocks...
rox2_OE
Detecting adapter sequence for read1...
>I7_Nextera_Transposase_1 | >Trans2_rc | >I7_Nextera_Transposase_1 | >Trans2_rc
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

Detecting adapter sequence for read2...
>I5_Nextera_Transposase_1 | >Trans1_rc | >I5_Nextera_Transposase_1 | >Trans1_rc
CTGTCTCTTATACACATCTGACGCTGCCGACGA

WARNING: fastp uses up to 16 threads although you specified 50
Read1 before filtering:
total reads: 17852151
total bases: 2677822650
Q20 bases: 2533817930(94.6223%)
Q30 bases: 2356033905(87.9832%)

Read2 before filtering:
total reads: 17852151
total bases: 2677822650
Q20 bases: 2628370097(98.1533%)
Q30 bases: 2515635155(93.9433%)

Read1 after filtering:
total reads: 17680442
total bases: 1922737123
Q20 bases: 1911026019(99.3909%)
Q30 bases: 1863858583(96.9378%)

Read2 after filtering:
total reads: 17680442
total bases: 1923663379
Q20 bases: 1895872097(98.5553%)
Q30 bases: 1821084749(94.6675%)

Filtering result:
reads passed filter: 35360884
reads failed due to low quality: 295198
reads failed due to too many N: 44666
reads failed due to too short: 3554
reads with adapter trimmed: 23892708
bases trimmed due to adapters: 1470086534

Duplication rate: 38.3336%

Insert size peak (evaluated by paired-end reads): 63

JSON report: rox2_OE.json
HTML report: rox2_OE.html

fastp -i rox2_OE_250926N_R1.fastq.gz -o rox2_OE_R1.fq.gz -I rox2_OE_250926N_R2.fastq.gz -O rox2_OE_R2.fq.gz -w 50 -j rox2_OE.json -h rox2_OE.html --detect_adapter_for_pe 
fastp v0.23.4, time used: 65 seconds
Time loading reference: 00:00:00
Time loading forward index: 00:00:00
Time loading mirror index: 00:00:00
Multiseed full-index search: 00:02:46
17680442 reads; of these:
  17680442 (100.00%) were paired; of these:
    14629554 (82.74%) aligned concordantly 0 times
    2137968 (12.09%) aligned concordantly exactly 1 time
    912920 (5.16%) aligned concordantly >1 times
17.26% overall alignment rate
Time searching: 00:02:46
Overall time: 00:02:46

sambamba 1.0.1
 by Artem Tarasov and Pjotr Prins (C) 2012-2023
    LDC 1.38.0 / DMD v2.108.1 / LLVM17.0.6 / bootstrap LDC - the LLVM D compiler (1.38.0)

finding positions of the duplicate reads in the file...
  sorted 2241580 end pairs
     and 0 single ends (among them 0 unmatched pairs)
  collecting indices of duplicate reads...   done in 433 ms
  found 2631878 duplicates
collected list of positions in 0 min 7 sec
removing duplicates...
collected list of positions in 0 min 15 sec
[bam_sort_core] merging from 0 files and 50 in-memory blocks...

for i in `ls *_R1.fq.gz`
do
    prefix=${i%%_R1.fq.gz}
    name=${i%%_R1*gz}
    echo $name

    bowtie2 -t -q -p 50 --local --very-sensitive-local --no-mixed --no-discordant --no-unal --phred33 -X 2000 -x '/home/share/iGenome/Escherichia_coli_K_12_MG1655/NCBI/2001-10-15/Sequence/Bowtie2Index/genome' -1 ${name}_R1.fq.gz -2 ${name}_R2.fq.gz -S ./${name}.sam
    samtools view -@ 50 -F 0x904 -q 20 -b -h -o ${name}.bam ${name}.sam 
	sambamba markdup -r -t 50 ${name}.bam ${name}.rmdup.bam
	samtools view -@ 50 -h ${name}.rmdup.bam | grep -v 'random'|grep -v 'chrUn'|grep -v 'chrM'|samtools view -@ 50 -bS -o ${name}.rmChr.bam
    samtools sort -@ 50 ${name}.rmChr.bam > ${name}_Ecoli.final.bam
	samtools index -@ 50 ${name}_Ecoli.final.bam

    total=`echo $(($(zcat ${i} | wc -l )/2))`
	map=`samtools view -@ 50 -c ${name}.bam`
	rmdup=`samtools view -@ 50 -c ${name}.rmdup.bam`
	final=`samtools view -@ 50 -c ${name}_Ecoli.final.bam`
	echo -e "${name} ${total} ${map} ${rmdup} ${final}" >> mapping_Ecoli.log

    rm ${name}.sam
    rm ${name}.bam
    rm ${name}.rmChr.bam
    rm ${name}.rmdup.bam
done

GFP_OE
Time loading reference: 00:00:00
Time loading forward index: 00:00:00
Time loading mirror index: 00:00:00
Multiseed full-index search: 00:02:38
21182137 reads; of these:
  21182137 (100.00%) were paired; of these:
    20787439 (98.14%) aligned concordantly 0 times
    376255 (1.78%) aligned concordantly exactly 1 time
    18443 (0.09%) aligned concordantly >1 times
1.86% overall alignment rate
Time searching: 00:02:38
Overall time: 00:02:38

sambamba 1.0.1
 by Artem Tarasov and Pjotr Prins (C) 2012-2023
    LDC 1.38.0 / DMD v2.108.1 / LLVM17.0.6 / bootstrap LDC - the LLVM D compiler (1.38.0)

finding positions of the duplicate reads in the file...
  sorted 382007 end pairs
     and 0 single ends (among them 0 unmatched pairs)
  collecting indices of duplicate reads...   done in 57 ms
  found 93256 duplicates
collected list of positions in 0 min 1 sec
removing duplicates...
collected list of positions in 0 min 2 sec
[bam_sort_core] merging from 0 files and 50 in-memory blocks...
rox2_OE
Time loading reference: 00:00:00
Time loading forward index: 00:00:00
Time loading mirror index: 00:00:00
Multiseed full-index search: 00:02:11
17680442 reads; of these:
  17680442 (100.00%) were paired; of these:
    17463014 (98.77%) aligned concordantly 0 times
    206845 (1.17%) aligned concordantly exactly 1 time
    10583 (0.06%) aligned concordantly >1 times
1.23% overall alignment rate
Time searching: 00:02:11
Overall time: 00:02:11

sambamba 1.0.1
 by Artem Tarasov and Pjotr Prins (C) 2012-2023
    LDC 1.38.0 / DMD v2.108.1 / LLVM17.0.6 / bootstrap LDC - the LLVM D compiler (1.38.0)

finding positions of the duplicate reads in the file...
  sorted 209852 end pairs
     and 0 single ends (among them 0 unmatched pairs)
  collecting indices of duplicate reads...   done in 33 ms
  found 130690 duplicates
collected list of positions in 0 min 0 sec
removing duplicates...
collected list of positions in 0 min 1 sec
[bam_sort_core] merging from 0 files and 50 in-memory blocks...

cat ./mapping.log

GFP_OE 42875700 20199084 15390920 14656476
rox2_OE 35704302 4483160 1851282 1687200

cat ./mapping_Ecoli.log

GFP_OE 42364274 764014 670758 670758
rox2_OE 35360884 419704 289014 289014

for i in `ls *_Ecoli.final.bam`
do
    name=${i%_Ecoli.final.bam}
    echo $name
    scaleFactor=`awk -v name="${name}" '$1==name {print 10000000/$5}' mapping_Ecoli.log`
    echo $scaleFactor
    bedtools genomecov -bg -scale $scaleFactor -ibam ${name}.final.bam > ${name}_norm.bedgraph
    bamCoverage -bs 20 --smoothLength 50 -p 50 -b ${name}.final.bam -o ${name}_20.bw --normalizeUsing None --scaleFactor $scaleFactor
done

GFP_OE
14.9085
bamFilesList: ['GFP_OE.final.bam']
binLength: 20
numberOfSamples: None
blackListFileName: None
skipZeroOverZero: False
bed_and_bin: False
genomeChunkSize: None
defaultFragmentLength: read length
numberOfProcessors: 50
verbose: False
region: None
bedFile: None
minMappingQuality: None
ignoreDuplicates: False
chrsToSkip: []
stepSize: 20
center_read: False
samFlag_include: None
samFlag_exclude: None
minFragmentLength: 0
maxFragmentLength: 0
zerosToNans: False
smoothLength: 50
save_data: False
out_file_for_raw_data: None
maxPairedFragmentLength: 1000
rox2_OE
34.6004
bamFilesList: ['rox2_OE.final.bam']
binLength: 20
numberOfSamples: None
blackListFileName: None
skipZeroOverZero: False
bed_and_bin: False
genomeChunkSize: None
defaultFragmentLength: read length
numberOfProcessors: 50
verbose: False
region: None
bedFile: None
minMappingQuality: None
ignoreDuplicates: False
chrsToSkip: []
stepSize: 20
center_read: False
samFlag_include: None
samFlag_exclude: None
minFragmentLength: 0
maxFragmentLength: 0
zerosToNans: False
smoothLength: 50
save_data: False
out_file_for_raw_data: None
maxPairedFragmentLength: 1000

fastqc -t 50 *.fastq.gz
multiqc ./

application/gzip
application/gzip
application/gzip
Started analysis of GFP_OE_250926N_R1.fastq.gz
application/gzip
Started analysis of GFP_OE_250926N_R2.fastq.gz
Started analysis of rox2_OE_250926N_R1.fastq.gz
Started analysis of rox2_OE_250926N_R2.fastq.gz
Approx 5% complete for rox2_OE_250926N_R1.fastq.gz
Approx 5% complete for rox2_OE_250926N_R2.fastq.gz
Approx 5% complete for GFP_OE_250926N_R2.fastq.gz
Approx 5% complete for GFP_OE_250926N_R1.fastq.gz
Approx 10% complete for rox2_OE_250926N_R1.fastq.gz
Approx 10% complete for rox2_OE_250926N_R2.fastq.gz
Approx 10% complete for GFP_OE_250926N_R2.fastq.gz
Approx 10% complete for GFP_OE_250926N_R1.fastq.gz
Approx 15% complete for rox2_OE_250926N_R1.fastq.gz
Approx 15% complete for rox2_OE_250926N_R2.fastq.gz
Approx 15% complete for GFP_OE_250926N_R2.fastq.gz
Approx 15% complete for GFP_OE_250926N_R1.fastq.gz
Approx 20% complete for rox2_OE_250926N_R1.fastq.gz
Approx 20% complete for rox2_OE_250926N_R2.fastq.gz
Approx 20% complete for GFP_OE_250926N_R2.fastq.gz
Approx 25% complete for rox2_OE_250926N_R2.fastq.gz
Approx 25% complete for rox2_OE_250926N_R1.fastq.gz
Approx 20% complete for GFP_OE_250926N_R1.fastq.gz
Approx 25% complete for GFP_OE_250926N_R2.fastq.gz
Approx 30% complete for rox2_OE_250926N_R2.fastq.gz
Approx 30% complete for rox2_OE_250926N_R1.fastq.gz
Approx 25% complete for GFP_OE_250926N_R1.fastq.gz
Approx 35% complete for rox2_OE_250926N_R2.fastq.gz
Approx 35% complete for rox2_OE_250926N_R1.fastq.gz
Approx 30% complete for GFP_OE_250926N_R2.fastq.gz
Approx 30% complete for GFP_OE_250926N_R1.fastq.gz
Approx 40% complete for rox2_OE_250926N_R2.fastq.gz
Approx 40% complete for rox2_OE_250926N_R1.fastq.gz
Approx 35% complete for GFP_OE_250926N_R2.fastq.gz
Approx 35% complete for GFP_OE_250926N_R1.fastq.gz
Approx 45% complete for rox2_OE_250926N_R2.fastq.gz
Approx 45% complete for rox2_OE_250926N_R1.fastq.gz
Approx 40% complete for GFP_OE_250926N_R2.fastq.gz
Approx 40% complete for GFP_OE_250926N_R1.fastq.gz
Approx 50% complete for rox2_OE_250926N_R2.fastq.gz
Approx 50% complete for rox2_OE_250926N_R1.fastq.gz
Approx 45% complete for GFP_OE_250926N_R2.fastq.gz
Approx 55% complete for rox2_OE_250926N_R2.fastq.gz
Approx 55% complete for rox2_OE_250926N_R1.fastq.gz
Approx 45% complete for GFP_OE_250926N_R1.fastq.gz
Approx 50% complete for GFP_OE_250926N_R2.fastq.gz
Approx 60% complete for rox2_OE_250926N_R2.fastq.gz
Approx 60% complete for rox2_OE_250926N_R1.fastq.gz
Approx 50% complete for GFP_OE_250926N_R1.fastq.gz
Approx 65% complete for rox2_OE_250926N_R2.fastq.gz
Approx 55% complete for GFP_OE_250926N_R2.fastq.gz
Approx 65% complete for rox2_OE_250926N_R1.fastq.gz
Approx 55% complete for GFP_OE_250926N_R1.fastq.gz
Approx 70% complete for rox2_OE_250926N_R2.fastq.gz
Approx 70% complete for rox2_OE_250926N_R1.fastq.gz
Approx 60% complete for GFP_OE_250926N_R2.fastq.gz
Approx 60% complete for GFP_OE_250926N_R1.fastq.gz
Approx 75% complete for rox2_OE_250926N_R2.fastq.gz
Approx 75% complete for rox2_OE_250926N_R1.fastq.gz
Approx 65% complete for GFP_OE_250926N_R2.fastq.gz
Approx 80% complete for rox2_OE_250926N_R2.fastq.gz
Approx 65% complete for GFP_OE_250926N_R1.fastq.gz
Approx 80% complete for rox2_OE_250926N_R1.fastq.gz
Approx 70% complete for GFP_OE_250926N_R2.fastq.gz
Approx 85% complete for rox2_OE_250926N_R2.fastq.gz
Approx 85% complete for rox2_OE_250926N_R1.fastq.gz
Approx 70% complete for GFP_OE_250926N_R1.fastq.gz
Approx 90% complete for rox2_OE_250926N_R2.fastq.gz
Approx 75% complete for GFP_OE_250926N_R2.fastq.gz
Approx 90% complete for rox2_OE_250926N_R1.fastq.gz
Approx 75% complete for GFP_OE_250926N_R1.fastq.gz
Approx 95% complete for rox2_OE_250926N_R2.fastq.gz
Approx 95% complete for rox2_OE_250926N_R1.fastq.gz
Approx 80% complete for GFP_OE_250926N_R2.fastq.gz
Analysis complete for rox2_OE_250926N_R2.fastq.gz
Approx 80% complete for GFP_OE_250926N_R1.fastq.gz
Analysis complete for rox2_OE_250926N_R1.fastq.gz
Approx 85% complete for GFP_OE_250926N_R2.fastq.gz
Approx 85% complete for GFP_OE_250926N_R1.fastq.gz
Approx 90% complete for GFP_OE_250926N_R2.fastq.gz
Approx 90% complete for GFP_OE_250926N_R1.fastq.gz
Approx 95% complete for GFP_OE_250926N_R2.fastq.gz
Approx 95% complete for GFP_OE_250926N_R1.fastq.gz
Analysis complete for GFP_OE_250926N_R2.fastq.gz
Analysis complete for GFP_OE_250926N_R1.fastq.gz

  [38;5;208m///[0m ]8;id=685770;https://multiqc.info\[1mMultiQC[0m]8;;\ 🔍 [2m| v1.17[0m

[34m|           multiqc[0m | Search path : /home/yhli/result/Dm-roX2OE-ATAC-202510/0_data
[2K[34m|[0m         [34msearching[0m | [38;5;70m━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━[0m [35m100%[0m [32m34/34[0m  m [35m 29%[0m [32m10/34[0m [2m./GFP_OE_20.bw[0m
[?25h[34m|            fastqc[0m | Found 4 reports
[34m|           multiqc[0m | Report      : multiqc_report.html
[34m|           multiqc[0m | Data        : multiqc_data
[34m|           multiqc[0m | MultiQC complete

macs call peak

bamCoverage & bamCompare

cd ../1_macs

for i in `ls ../0_data/*.final.bam`
do
    name=${i%%.final.bam}
    name=${name##*/}
    echo $name

    bamCoverage -bs 20 -p 50 -b $i -o ${name}_20_RPKM.bw --normalizeUsing RPKM
    # bamCoverage -bs 20 -p 50 -b $i -o ${name}_20.bw --normalizeUsing None 
    bamCoverage -bs 20 -p 50 -b $i -o ${name}_20_RPKM.bdg --normalizeUsing RPKM --outFileFormat bedgraph
    # bamCoverage -bs 20 -p 50 -b $i -o ${name}_20.bdg --normalizeUsing None --outFileFormat bedgraph
done

GFP_OE_Ecoli
normalization: RPKM
bamFilesList: ['../0_data/GFP_OE_Ecoli.final.bam']
binLength: 20
numberOfSamples: None
blackListFileName: None
skipZeroOverZero: False
bed_and_bin: False
genomeChunkSize: None
defaultFragmentLength: read length
numberOfProcessors: 50
verbose: False
region: None
bedFile: None
minMappingQuality: None
ignoreDuplicates: False
chrsToSkip: []
stepSize: 20
center_read: False
samFlag_include: None
samFlag_exclude: None
minFragmentLength: 0
maxFragmentLength: 0
zerosToNans: False
smoothLength: None
save_data: False
out_file_for_raw_data: None
maxPairedFragmentLength: 1000
normalization: RPKM
bamFilesList: ['../0_data/GFP_OE_Ecoli.final.bam']
binLength: 20
numberOfSamples: None
blackListFileName: None
skipZeroOverZero: False
bed_and_bin: False
genomeChunkSize: None
defaultFragmentLength: read length
numberOfProcessors: 50
verbose: False
region: None
bedFile: None
minMappingQuality: None
ignoreDuplicates: False
chrsToSkip: []
stepSize: 20
center_read: False
samFlag_include: None
samFlag_exclude: None
minFragmentLength: 0
maxFragmentLength: 0
zerosToNans: False
smoothLength: None
save_data: False
out_file_for_raw_data: None
maxPairedFragmentLength: 1000
GFP_OE
normalization: RPKM
bamFilesList: ['../0_data/GFP_OE.final.bam']
binLength: 20
numberOfSamples: None
blackListFileName: None
skipZeroOverZero: False
bed_and_bin: False
genomeChunkSize: None
defaultFragmentLength: read length
numberOfProcessors: 50
verbose: False
region: None
bedFile: None
minMappingQuality: None
ignoreDuplicates: False
chrsToSkip: []
stepSize: 20
center_read: False
samFlag_include: None
samFlag_exclude: None
minFragmentLength: 0
maxFragmentLength: 0
zerosToNans: False
smoothLength: None
save_data: False
out_file_for_raw_data: None
maxPairedFragmentLength: 1000
normalization: RPKM
bamFilesList: ['../0_data/GFP_OE.final.bam']
binLength: 20
numberOfSamples: None
blackListFileName: None
skipZeroOverZero: False
bed_and_bin: False
genomeChunkSize: None
defaultFragmentLength: read length
numberOfProcessors: 50
verbose: False
region: None
bedFile: None
minMappingQuality: None
ignoreDuplicates: False
chrsToSkip: []
stepSize: 20
center_read: False
samFlag_include: None
samFlag_exclude: None
minFragmentLength: 0
maxFragmentLength: 0
zerosToNans: False
smoothLength: None
save_data: False
out_file_for_raw_data: None
maxPairedFragmentLength: 1000
rox2_OE_Ecoli
normalization: RPKM
bamFilesList: ['../0_data/rox2_OE_Ecoli.final.bam']
binLength: 20
numberOfSamples: None
blackListFileName: None
skipZeroOverZero: False
bed_and_bin: False
genomeChunkSize: None
defaultFragmentLength: read length
numberOfProcessors: 50
verbose: False
region: None
bedFile: None
minMappingQuality: None
ignoreDuplicates: False
chrsToSkip: []
stepSize: 20
center_read: False
samFlag_include: None
samFlag_exclude: None
minFragmentLength: 0
maxFragmentLength: 0
zerosToNans: False
smoothLength: None
save_data: False
out_file_for_raw_data: None
maxPairedFragmentLength: 1000
normalization: RPKM
bamFilesList: ['../0_data/rox2_OE_Ecoli.final.bam']
binLength: 20
numberOfSamples: None
blackListFileName: None
skipZeroOverZero: False
bed_and_bin: False
genomeChunkSize: None
defaultFragmentLength: read length
numberOfProcessors: 50
verbose: False
region: None
bedFile: None
minMappingQuality: None
ignoreDuplicates: False
chrsToSkip: []
stepSize: 20
center_read: False
samFlag_include: None
samFlag_exclude: None
minFragmentLength: 0
maxFragmentLength: 0
zerosToNans: False
smoothLength: None
save_data: False
out_file_for_raw_data: None
maxPairedFragmentLength: 1000
rox2_OE
normalization: RPKM
bamFilesList: ['../0_data/rox2_OE.final.bam']
binLength: 20
numberOfSamples: None
blackListFileName: None
skipZeroOverZero: False
bed_and_bin: False
genomeChunkSize: None
defaultFragmentLength: read length
numberOfProcessors: 50
verbose: False
region: None
bedFile: None
minMappingQuality: None
ignoreDuplicates: False
chrsToSkip: []
stepSize: 20
center_read: False
samFlag_include: None
samFlag_exclude: None
minFragmentLength: 0
maxFragmentLength: 0
zerosToNans: False
smoothLength: None
save_data: False
out_file_for_raw_data: None
maxPairedFragmentLength: 1000
normalization: RPKM
bamFilesList: ['../0_data/rox2_OE.final.bam']
binLength: 20
numberOfSamples: None
blackListFileName: None
skipZeroOverZero: False
bed_and_bin: False
genomeChunkSize: None
defaultFragmentLength: read length
numberOfProcessors: 50
verbose: False
region: None
bedFile: None
minMappingQuality: None
ignoreDuplicates: False
chrsToSkip: []
stepSize: 20
center_read: False
samFlag_include: None
samFlag_exclude: None
minFragmentLength: 0
maxFragmentLength: 0
zerosToNans: False
smoothLength: None
save_data: False
out_file_for_raw_data: None
maxPairedFragmentLength: 1000

computeMatrix scale-regions -p 50 -R '/home/share/chipRef/dm6_genes.bed' --missingDataAsZero -a 3000 -b 3000 -m 5000 -bs 20 -S './GFP_OE_20_RPKM.bw' './rox2_OE_20_RPKM.bw' --samplesLabel GFP-OE roX2-OE -o matrix.mat.gz
plotHeatmap -m matrix.mat.gz -o heatmap_RPKM.png --colorMap coolwarm --heatmapHeight 12 --heatmapWidth 6 --perGroup

Skipping NM_001015101, due to being absent in the computeMatrix output.
Skipping NM_001015100, due to being absent in the computeMatrix output.
Skipping NM_001110584, due to being absent in the computeMatrix output.
Skipping NR_133556, due to being absent in the computeMatrix output.
Skipping NR_133556_r1, due to being absent in the computeMatrix output.
Skipping NR_133556_r2, due to being absent in the computeMatrix output.
Skipping NR_133555, due to being absent in the computeMatrix output.
Skipping NR_133555_r1, due to being absent in the computeMatrix output.
Skipping NR_133555_r2, due to being absent in the computeMatrix output.
Skipping NR_133554, due to being absent in the computeMatrix output.
Skipping NR_133554_r1, due to being absent in the computeMatrix output.
Skipping NR_133554_r2, due to being absent in the computeMatrix output.
Skipping NR_133553, due to being absent in the computeMatrix output.
Skipping NR_133553_r1, due to being absent in the computeMatrix output.
Skipping NR_133552_r2, due to being absent in the computeMatrix output.
Skipping NR_133552_r3, due to being absent in the computeMatrix output.
Skipping NR_133552_r4, due to being absent in the computeMatrix output.
Skipping NR_133551, due to being absent in the computeMatrix output.
Skipping NR_133551_r1, due to being absent in the computeMatrix output.
Skipping NR_133551_r2, due to being absent in the computeMatrix output.
Skipping NR_133550, due to being absent in the computeMatrix output.
Skipping NR_133550_r1, due to being absent in the computeMatrix output.
Skipping NR_133550_r2, due to being absent in the computeMatrix output.
Skipping NR_133549, due to being absent in the computeMatrix output.
Skipping NR_133549_r1, due to being absent in the computeMatrix output.
Skipping NR_133545_r2, due to being absent in the computeMatrix output.
Skipping NR_133545_r3, due to being absent in the computeMatrix output.
Skipping NR_133545_r4, due to being absent in the computeMatrix output.
Skipping NR_133560, due to being absent in the computeMatrix output.
Skipping NR_133559, due to being absent in the computeMatrix output.
Skipping NR_133559_r1, due to being absent in the computeMatrix output.
Skipping NR_133559_r2, due to being absent in the computeMatrix output.
Skipping NR_133558, due to being absent in the computeMatrix output.
Skipping NR_133557_r2, due to being absent in the computeMatrix output.
Skipping NR_133557_r3, due to being absent in the computeMatrix output.
Skipping NR_133557_r4, due to being absent in the computeMatrix output.
Skipping NR_133562, due to being absent in the computeMatrix output.
Skipping NR_133561_r2, due to being absent in the computeMatrix output.
Skipping NR_133561_r3, due to being absent in the computeMatrix output.
Skipping NR_133561_r4, due to being absent in the computeMatrix output.
Skipping NR_133560_r1, due to being absent in the computeMatrix output.
Skipping NR_133560_r2, due to being absent in the computeMatrix output.
Skipping NR_156799_r3, due to being absent in the computeMatrix output.
Skipping NR_156799_r4, due to being absent in the computeMatrix output.
Skipping NR_156798_r3, due to being absent in the computeMatrix output.
Skipping NR_156798_r4, due to being absent in the computeMatrix output.
Skipping NR_163218_r3, due to being absent in the computeMatrix output.
Skipping NR_163218_r4, due to being absent in the computeMatrix output.
Skipping NR_163217_r3, due to being absent in the computeMatrix output.
Skipping NR_163217_r4, due to being absent in the computeMatrix output.
Skipping NR_163216_r3, due to being absent in the computeMatrix output.
Skipping NR_163216_r4, due to being absent in the computeMatrix output.
Skipping NM_001110608, due to being absent in the computeMatrix output.
Skipping NR_133552_r5, due to being absent in the computeMatrix output.
Skipping NR_133545_r5, due to being absent in the computeMatrix output.
Skipping NR_133557_r5, due to being absent in the computeMatrix output.
Skipping NR_133561_r5, due to being absent in the computeMatrix output.
Skipping NR_133552_r6, due to being absent in the computeMatrix output.
Skipping NR_133545_r6, due to being absent in the computeMatrix output.
Skipping NR_133557_r6, due to being absent in the computeMatrix output.
Skipping NR_133561_r6, due to being absent in the computeMatrix output.
Skipping NR_048533, due to being absent in the computeMatrix output.
Skipping NR_156799_r5, due to being absent in the computeMatrix output.
Skipping NR_156798_r5, due to being absent in the computeMatrix output.
Skipping NR_163218_r5, due to being absent in the computeMatrix output.
Skipping NR_163217_r5, due to being absent in the computeMatrix output.
Skipping NR_163216_r5, due to being absent in the computeMatrix output.
Skipping NR_133552_r7, due to being absent in the computeMatrix output.
Skipping NR_133545_r7, due to being absent in the computeMatrix output.
Skipping NR_133557_r7, due to being absent in the computeMatrix output.
Skipping NR_133561_r7, due to being absent in the computeMatrix output.
Skipping NR_156799_r6, due to being absent in the computeMatrix output.
Skipping NR_156798_r6, due to being absent in the computeMatrix output.
Skipping NR_163218_r6, due to being absent in the computeMatrix output.
Skipping NR_163217_r6, due to being absent in the computeMatrix output.
Skipping NR_163216_r6, due to being absent in the computeMatrix output.
Skipping NR_133552_r8, due to being absent in the computeMatrix output.
Skipping NR_133545_r8, due to being absent in the computeMatrix output.
Skipping NR_133557_r8, due to being absent in the computeMatrix output.
Skipping NR_133561_r8, due to being absent in the computeMatrix output.
Skipping NR_133556_r3, due to being absent in the computeMatrix output.
Skipping NR_133552_r9, due to being absent in the computeMatrix output.
Skipping NR_133551_r3, due to being absent in the computeMatrix output.
Skipping NR_133545_r9, due to being absent in the computeMatrix output.
Skipping NR_133560_r3, due to being absent in the computeMatrix output.
Skipping NR_133557_r9, due to being absent in the computeMatrix output.
Skipping NR_133561_r9, due to being absent in the computeMatrix output.
Skipping NR_156799_r7, due to being absent in the computeMatrix output.
Skipping NR_156798_r7, due to being absent in the computeMatrix output.
Skipping NR_163218_r7, due to being absent in the computeMatrix output.
Skipping NR_163217_r7, due to being absent in the computeMatrix output.
Skipping NR_163216_r7, due to being absent in the computeMatrix output.
Skipping NR_133552_r10, due to being absent in the computeMatrix output.
Skipping NR_133545_r10, due to being absent in the computeMatrix output.
Skipping NR_133557_r10, due to being absent in the computeMatrix output.
Skipping NR_133561_r10, due to being absent in the computeMatrix output.
Skipping NR_133557_r11, due to being absent in the computeMatrix output.
Skipping NR_133556_r4, due to being absent in the computeMatrix output.
Skipping NR_133552_r11, due to being absent in the computeMatrix output.
Skipping NR_133551_r4, due to being absent in the computeMatrix output.
Skipping NR_133545_r11, due to being absent in the computeMatrix output.
Skipping NR_133560_r4, due to being absent in the computeMatrix output.
Skipping NR_133561_r11, due to being absent in the computeMatrix output.
Skipping NR_156799_r8, due to being absent in the computeMatrix output.
Skipping NR_156798_r8, due to being absent in the computeMatrix output.
Skipping NR_163218_r8, due to being absent in the computeMatrix output.
Skipping NR_163217_r8, due to being absent in the computeMatrix output.
Skipping NR_163216_r8, due to being absent in the computeMatrix output.
Skipping NR_133557_r12, due to being absent in the computeMatrix output.
Skipping NR_133556_r5, due to being absent in the computeMatrix output.
Skipping NR_133552_r12, due to being absent in the computeMatrix output.
Skipping NR_133551_r5, due to being absent in the computeMatrix output.
Skipping NR_133545_r12, due to being absent in the computeMatrix output.
Skipping NR_133560_r5, due to being absent in the computeMatrix output.
Skipping NR_133561_r12, due to being absent in the computeMatrix output.
Skipping NM_001144069_r1, due to being absent in the computeMatrix output.
Skipping NR_133557_r13, due to being absent in the computeMatrix output.
Skipping NR_133556_r6, due to being absent in the computeMatrix output.
Skipping NR_133552_r13, due to being absent in the computeMatrix output.
Skipping NR_133551_r6, due to being absent in the computeMatrix output.
Skipping NR_133545_r13, due to being absent in the computeMatrix output.
Skipping NR_133560_r6, due to being absent in the computeMatrix output.
Skipping NR_133561_r13, due to being absent in the computeMatrix output.
Skipping NR_156799_r9, due to being absent in the computeMatrix output.
Skipping NR_156798_r9, due to being absent in the computeMatrix output.
Skipping NR_163218_r9, due to being absent in the computeMatrix output.
Skipping NR_163217_r9, due to being absent in the computeMatrix output.
Skipping NR_163216_r9, due to being absent in the computeMatrix output.
Skipping NM_001316662_r1, due to being absent in the computeMatrix output.
Skipping NR_026600_r1, due to being absent in the computeMatrix output.
Skipping NR_133547_r1, due to being absent in the computeMatrix output.
Skipping NR_125439_r1, due to being absent in the computeMatrix output.
Skipping NR_026603_r1, due to being absent in the computeMatrix output.
Skipping NR_026602_r1, due to being absent in the computeMatrix output.
Skipping NR_125438_r1, due to being absent in the computeMatrix output.
Skipping NR_026605, due to being absent in the computeMatrix output.
Skipping NR_026612, due to being absent in the computeMatrix output.
Skipping NR_026627, due to being absent in the computeMatrix output.
Skipping NM_001110696, due to being absent in the computeMatrix output.
Skipping NR_026633, due to being absent in the computeMatrix output.
Skipping NR_048534, due to being absent in the computeMatrix output.

computeMatrix scale-regions -p 50 -R '/home/share/chipRef/dm6_genes.bed' --missingDataAsZero -a 3000 -b 3000 -m 5000 -bs 20 -S '../0_data/GFP_OE_20.bw' '../0_data/rox2_OE_20.bw' --samplesLabel GFP-OE roX2-OE -o matrix.mat.gz
plotHeatmap -m matrix.mat.gz -o heatmap.png --colorMap coolwarm --heatmapHeight 12 --heatmapWidth 6 --perGroup

Skipping NM_001015101, due to being absent in the computeMatrix output.
Skipping NM_001015100, due to being absent in the computeMatrix output.
Skipping NM_001110584, due to being absent in the computeMatrix output.
Skipping NR_133556, due to being absent in the computeMatrix output.
Skipping NR_133556_r1, due to being absent in the computeMatrix output.
Skipping NR_133556_r2, due to being absent in the computeMatrix output.
Skipping NR_133555, due to being absent in the computeMatrix output.
Skipping NR_133555_r1, due to being absent in the computeMatrix output.
Skipping NR_133555_r2, due to being absent in the computeMatrix output.
Skipping NR_133554, due to being absent in the computeMatrix output.
Skipping NR_133554_r1, due to being absent in the computeMatrix output.
Skipping NR_133554_r2, due to being absent in the computeMatrix output.
Skipping NR_133553, due to being absent in the computeMatrix output.
Skipping NR_133553_r1, due to being absent in the computeMatrix output.
Skipping NR_133552_r2, due to being absent in the computeMatrix output.
Skipping NR_133552_r3, due to being absent in the computeMatrix output.
Skipping NR_133552_r4, due to being absent in the computeMatrix output.
Skipping NR_133551, due to being absent in the computeMatrix output.
Skipping NR_133551_r1, due to being absent in the computeMatrix output.
Skipping NR_133551_r2, due to being absent in the computeMatrix output.
Skipping NR_133550, due to being absent in the computeMatrix output.
Skipping NR_133550_r1, due to being absent in the computeMatrix output.
Skipping NR_133550_r2, due to being absent in the computeMatrix output.
Skipping NR_133549, due to being absent in the computeMatrix output.
Skipping NR_133549_r1, due to being absent in the computeMatrix output.
Skipping NR_133545_r2, due to being absent in the computeMatrix output.
Skipping NR_133545_r3, due to being absent in the computeMatrix output.
Skipping NR_133545_r4, due to being absent in the computeMatrix output.
Skipping NR_133560, due to being absent in the computeMatrix output.
Skipping NR_133559, due to being absent in the computeMatrix output.
Skipping NR_133559_r1, due to being absent in the computeMatrix output.
Skipping NR_133559_r2, due to being absent in the computeMatrix output.
Skipping NR_133558, due to being absent in the computeMatrix output.
Skipping NR_133557_r2, due to being absent in the computeMatrix output.
Skipping NR_133557_r3, due to being absent in the computeMatrix output.
Skipping NR_133557_r4, due to being absent in the computeMatrix output.
Skipping NR_133562, due to being absent in the computeMatrix output.
Skipping NR_133561_r2, due to being absent in the computeMatrix output.
Skipping NR_133561_r3, due to being absent in the computeMatrix output.
Skipping NR_133561_r4, due to being absent in the computeMatrix output.
Skipping NR_133560_r1, due to being absent in the computeMatrix output.
Skipping NR_133560_r2, due to being absent in the computeMatrix output.
Skipping NR_156799_r3, due to being absent in the computeMatrix output.
Skipping NR_156799_r4, due to being absent in the computeMatrix output.
Skipping NR_156798_r3, due to being absent in the computeMatrix output.
Skipping NR_156798_r4, due to being absent in the computeMatrix output.
Skipping NR_163218_r3, due to being absent in the computeMatrix output.
Skipping NR_163218_r4, due to being absent in the computeMatrix output.
Skipping NR_163217_r3, due to being absent in the computeMatrix output.
Skipping NR_163217_r4, due to being absent in the computeMatrix output.
Skipping NR_163216_r3, due to being absent in the computeMatrix output.
Skipping NR_163216_r4, due to being absent in the computeMatrix output.
Skipping NM_001110608, due to being absent in the computeMatrix output.
Skipping NR_133552_r5, due to being absent in the computeMatrix output.
Skipping NR_133545_r5, due to being absent in the computeMatrix output.
Skipping NR_133557_r5, due to being absent in the computeMatrix output.
Skipping NR_133561_r5, due to being absent in the computeMatrix output.
Skipping NR_133552_r6, due to being absent in the computeMatrix output.
Skipping NR_133545_r6, due to being absent in the computeMatrix output.
Skipping NR_133557_r6, due to being absent in the computeMatrix output.
Skipping NR_133561_r6, due to being absent in the computeMatrix output.
Skipping NR_048533, due to being absent in the computeMatrix output.
Skipping NR_156799_r5, due to being absent in the computeMatrix output.
Skipping NR_156798_r5, due to being absent in the computeMatrix output.
Skipping NR_163218_r5, due to being absent in the computeMatrix output.
Skipping NR_163217_r5, due to being absent in the computeMatrix output.
Skipping NR_163216_r5, due to being absent in the computeMatrix output.
Skipping NR_133552_r7, due to being absent in the computeMatrix output.
Skipping NR_133545_r7, due to being absent in the computeMatrix output.
Skipping NR_133557_r7, due to being absent in the computeMatrix output.
Skipping NR_133561_r7, due to being absent in the computeMatrix output.
Skipping NR_156799_r6, due to being absent in the computeMatrix output.
Skipping NR_156798_r6, due to being absent in the computeMatrix output.
Skipping NR_163218_r6, due to being absent in the computeMatrix output.
Skipping NR_163217_r6, due to being absent in the computeMatrix output.
Skipping NR_163216_r6, due to being absent in the computeMatrix output.
Skipping NR_133552_r8, due to being absent in the computeMatrix output.
Skipping NR_133545_r8, due to being absent in the computeMatrix output.
Skipping NR_133557_r8, due to being absent in the computeMatrix output.
Skipping NR_133561_r8, due to being absent in the computeMatrix output.
Skipping NR_133556_r3, due to being absent in the computeMatrix output.
Skipping NR_133552_r9, due to being absent in the computeMatrix output.
Skipping NR_133551_r3, due to being absent in the computeMatrix output.
Skipping NR_133545_r9, due to being absent in the computeMatrix output.
Skipping NR_133560_r3, due to being absent in the computeMatrix output.
Skipping NR_133557_r9, due to being absent in the computeMatrix output.
Skipping NR_133561_r9, due to being absent in the computeMatrix output.
Skipping NR_156799_r7, due to being absent in the computeMatrix output.
Skipping NR_156798_r7, due to being absent in the computeMatrix output.
Skipping NR_163218_r7, due to being absent in the computeMatrix output.
Skipping NR_163217_r7, due to being absent in the computeMatrix output.
Skipping NR_163216_r7, due to being absent in the computeMatrix output.
Skipping NR_133552_r10, due to being absent in the computeMatrix output.
Skipping NR_133545_r10, due to being absent in the computeMatrix output.
Skipping NR_133557_r10, due to being absent in the computeMatrix output.
Skipping NR_133561_r10, due to being absent in the computeMatrix output.
Skipping NR_133557_r11, due to being absent in the computeMatrix output.
Skipping NR_133556_r4, due to being absent in the computeMatrix output.
Skipping NR_133552_r11, due to being absent in the computeMatrix output.
Skipping NR_133551_r4, due to being absent in the computeMatrix output.
Skipping NR_133545_r11, due to being absent in the computeMatrix output.
Skipping NR_133560_r4, due to being absent in the computeMatrix output.
Skipping NR_133561_r11, due to being absent in the computeMatrix output.
Skipping NR_156799_r8, due to being absent in the computeMatrix output.
Skipping NR_156798_r8, due to being absent in the computeMatrix output.
Skipping NR_163218_r8, due to being absent in the computeMatrix output.
Skipping NR_163217_r8, due to being absent in the computeMatrix output.
Skipping NR_163216_r8, due to being absent in the computeMatrix output.
Skipping NR_133557_r12, due to being absent in the computeMatrix output.
Skipping NR_133556_r5, due to being absent in the computeMatrix output.
Skipping NR_133552_r12, due to being absent in the computeMatrix output.
Skipping NR_133551_r5, due to being absent in the computeMatrix output.
Skipping NR_133545_r12, due to being absent in the computeMatrix output.
Skipping NR_133560_r5, due to being absent in the computeMatrix output.
Skipping NR_133561_r12, due to being absent in the computeMatrix output.
Skipping NM_001144069_r1, due to being absent in the computeMatrix output.
Skipping NR_133557_r13, due to being absent in the computeMatrix output.
Skipping NR_133556_r6, due to being absent in the computeMatrix output.
Skipping NR_133552_r13, due to being absent in the computeMatrix output.
Skipping NR_133551_r6, due to being absent in the computeMatrix output.
Skipping NR_133545_r13, due to being absent in the computeMatrix output.
Skipping NR_133560_r6, due to being absent in the computeMatrix output.
Skipping NR_133561_r13, due to being absent in the computeMatrix output.
Skipping NR_156799_r9, due to being absent in the computeMatrix output.
Skipping NR_156798_r9, due to being absent in the computeMatrix output.
Skipping NR_163218_r9, due to being absent in the computeMatrix output.
Skipping NR_163217_r9, due to being absent in the computeMatrix output.
Skipping NR_163216_r9, due to being absent in the computeMatrix output.
Skipping NM_001316662_r1, due to being absent in the computeMatrix output.
Skipping NR_026600_r1, due to being absent in the computeMatrix output.
Skipping NR_133547_r1, due to being absent in the computeMatrix output.
Skipping NR_125439_r1, due to being absent in the computeMatrix output.
Skipping NR_026603_r1, due to being absent in the computeMatrix output.
Skipping NR_026602_r1, due to being absent in the computeMatrix output.
Skipping NR_125438_r1, due to being absent in the computeMatrix output.
Skipping NR_026605, due to being absent in the computeMatrix output.
Skipping NR_026612, due to being absent in the computeMatrix output.
Skipping NR_026627, due to being absent in the computeMatrix output.
Skipping NM_001110696, due to being absent in the computeMatrix output.
Skipping NR_026633, due to being absent in the computeMatrix output.
Skipping NR_048534, due to being absent in the computeMatrix output.

macs3 callpeak  -t '../0_data/GFP_OE.final.bam'  -g dm -n GFP_OE --shift -100 --extsize 200 --nomodel -B -f BAMPE 
macs3 callpeak  -t '../0_data/rox2_OE.final.bam' -g dm -n roX2_OE --shift -100 --extsize 200 --nomodel -B -f BAMPE

INFO  @ 13 Nov 2025 15:26:39: [44 MB] 
# Command line: callpeak -t ../0_data/GFP_OE.final.bam -g dm -n GFP_OE --shift -100 --extsize 200 --nomodel -B -f BAMPE
# ARGUMENTS LIST:
# name = GFP_OE
# format = BAMPE
# ChIP-seq file = ['../0_data/GFP_OE.final.bam']
# control file = None
# effective genome size = 1.43e+08
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is on
 
INFO  @ 13 Nov 2025 15:26:39: [44 MB] #1 read fragment files... 
INFO  @ 13 Nov 2025 15:26:39: [44 MB] #1 read treatment fragments... 
INFO  @ 13 Nov 2025 15:26:44: [83 MB]  1000000 fragments parsed 
INFO  @ 13 Nov 2025 15:26:48: [96 MB]  2000000 fragments parsed 
INFO  @ 13 Nov 2025 15:26:52: [104 MB]  3000000 fragments parsed 
INFO  @ 13 Nov 2025 15:26:56: [115 MB]  4000000 fragments parsed 
INFO  @ 13 Nov 2025 15:27:01: [118 MB]  5000000 fragments parsed 
INFO  @ 13 Nov 2025 15:27:05: [131 MB]  6000000 fragments parsed 
INFO  @ 13 Nov 2025 15:27:09: [139 MB]  7000000 fragments parsed 
INFO  @ 13 Nov 2025 15:27:10: [142 MB] 7328238 fragments have been read. 
INFO  @ 13 Nov 2025 15:27:16: [142 MB] #1 mean fragment size is determined as 154.7 bp from treatment 
INFO  @ 13 Nov 2025 15:27:16: [142 MB] #1 fragment size = 154.7 
INFO  @ 13 Nov 2025 15:27:16: [142 MB] #1  total fragments in treatment: 7328238 
INFO  @ 13 Nov 2025 15:27:16: [142 MB] #1 user defined the maximum fragments... 
INFO  @ 13 Nov 2025 15:27:16: [142 MB] #1 filter out redundant fragments by allowing at most 1 identical fragment(s) 
INFO  @ 13 Nov 2025 15:27:28: [142 MB] #1  fragments after filtering in treatment: 7326315 
INFO  @ 13 Nov 2025 15:27:28: [142 MB] #1  Redundant rate of treatment: 0.00 
INFO  @ 13 Nov 2025 15:27:28: [142 MB] #1 finished! 
INFO  @ 13 Nov 2025 15:27:28: [142 MB] #2 Build Peak Model... 
INFO  @ 13 Nov 2025 15:27:28: [142 MB] #2 Skipped... 
INFO  @ 13 Nov 2025 15:27:28: [142 MB] #3 Call peaks... 
INFO  @ 13 Nov 2025 15:27:28: [142 MB] #3 Pre-compute pvalue-qvalue table... 
INFO  @ 13 Nov 2025 15:27:54: [803 MB] #3 In the peak calling step, the following will be performed simultaneously: 
INFO  @ 13 Nov 2025 15:27:54: [803 MB] #3   Write bedGraph files for treatment pileup (after scaling if necessary)... GFP_OE_treat_pileup.bdg 
INFO  @ 13 Nov 2025 15:27:54: [803 MB] #3   Write bedGraph files for control lambda (after scaling if necessary)... GFP_OE_control_lambda.bdg 
INFO  @ 13 Nov 2025 15:27:54: [803 MB] #3   Pileup will be based on sequencing depth in treatment. 
INFO  @ 13 Nov 2025 15:27:54: [803 MB] #3 Call peaks for each chromosome... 
INFO  @ 13 Nov 2025 15:28:25: [803 MB] #4 Write output xls file... GFP_OE_peaks.xls 
INFO  @ 13 Nov 2025 15:28:25: [803 MB] #4 Write peak in narrowPeak format file... GFP_OE_peaks.narrowPeak 
INFO  @ 13 Nov 2025 15:28:25: [803 MB] #4 Write summits bed file... GFP_OE_summits.bed 
INFO  @ 13 Nov 2025 15:28:25: [803 MB] Done! 
INFO  @ 13 Nov 2025 15:28:26: [44 MB] 
# Command line: callpeak -t ../0_data/rox2_OE.final.bam -g dm -n roX2_OE --shift -100 --extsize 200 --nomodel -B -f BAMPE
# ARGUMENTS LIST:
# name = roX2_OE
# format = BAMPE
# ChIP-seq file = ['../0_data/rox2_OE.final.bam']
# control file = None
# effective genome size = 1.43e+08
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is on
 
INFO  @ 13 Nov 2025 15:28:26: [44 MB] #1 read fragment files... 
INFO  @ 13 Nov 2025 15:28:26: [44 MB] #1 read treatment fragments... 
INFO  @ 13 Nov 2025 15:28:30: [84 MB] 843600 fragments have been read. 
INFO  @ 13 Nov 2025 15:28:30: [84 MB] #1 mean fragment size is determined as 175.2 bp from treatment 
INFO  @ 13 Nov 2025 15:28:30: [84 MB] #1 fragment size = 175.2 
INFO  @ 13 Nov 2025 15:28:30: [84 MB] #1  total fragments in treatment: 843600 
INFO  @ 13 Nov 2025 15:28:30: [84 MB] #1 user defined the maximum fragments... 
INFO  @ 13 Nov 2025 15:28:30: [84 MB] #1 filter out redundant fragments by allowing at most 1 identical fragment(s) 
INFO  @ 13 Nov 2025 15:28:31: [84 MB] #1  fragments after filtering in treatment: 815963 
INFO  @ 13 Nov 2025 15:28:31: [84 MB] #1  Redundant rate of treatment: 0.03 
INFO  @ 13 Nov 2025 15:28:31: [84 MB] #1 finished! 
INFO  @ 13 Nov 2025 15:28:31: [84 MB] #2 Build Peak Model... 
INFO  @ 13 Nov 2025 15:28:31: [84 MB] #2 Skipped... 
INFO  @ 13 Nov 2025 15:28:31: [84 MB] #3 Call peaks... 
INFO  @ 13 Nov 2025 15:28:31: [84 MB] #3 Pre-compute pvalue-qvalue table... 
INFO  @ 13 Nov 2025 15:28:35: [147 MB] #3 In the peak calling step, the following will be performed simultaneously: 
INFO  @ 13 Nov 2025 15:28:35: [147 MB] #3   Write bedGraph files for treatment pileup (after scaling if necessary)... roX2_OE_treat_pileup.bdg 
INFO  @ 13 Nov 2025 15:28:35: [147 MB] #3   Write bedGraph files for control lambda (after scaling if necessary)... roX2_OE_control_lambda.bdg 
INFO  @ 13 Nov 2025 15:28:35: [147 MB] #3   Pileup will be based on sequencing depth in treatment. 
INFO  @ 13 Nov 2025 15:28:35: [147 MB] #3 Call peaks for each chromosome... 
INFO  @ 13 Nov 2025 15:28:38: [147 MB] #4 Write output xls file... roX2_OE_peaks.xls 
INFO  @ 13 Nov 2025 15:28:38: [147 MB] #4 Write peak in narrowPeak format file... roX2_OE_peaks.narrowPeak 
INFO  @ 13 Nov 2025 15:28:38: [147 MB] #4 Write summits bed file... roX2_OE_summits.bed 
INFO  @ 13 Nov 2025 15:28:38: [147 MB] Done!

wc -l *narrowPeak

  21337 GFP_OE_peaks.narrowPeak
   2070 roX2_OE_peaks.narrowPeak
  23407 总计

FRiP

total=$(samtools view -c ../0_data/GFP_OE.final.bam)
peak=$(bedtools sort -i ./GFP_OE_peaks.narrowPeak | bedtools merge -i stdin | bedtools intersect -u -nonamecheck -a ../0_data/GFP_OE.final.bam -b stdin -ubam | samtools view -c)
frip=$(bc<<<"scale=2;100*$peak/$total")
echo "GFP_OE: $frip %"

GFP_OE: 24.22 %

total=$(samtools view -c ../0_data/rox2_OE.final.bam)
peak=$(bedtools sort -i ./roX2_OE_peaks.narrowPeak | bedtools merge -i stdin | bedtools intersect -u -nonamecheck -a ../0_data/rox2_OE.final.bam -b stdin -ubam | samtools view -c)
frip=$(bc<<<"scale=2;100*$peak/$total")
echo "roX2_OE: $frip %"

roX2_OE: 16.24 %

filter peak

awk 'BEGIN {OFS="\t"} {print $1, $2, $3, "", $4}' ../0_data/GFP_OE_norm.bedgraph| awk '$4 >= 50' > GFP_OE_check.bed
awk 'BEGIN {OFS="\t"} {print $1, $2, $3, "", $4}' ../0_data/rox2_OE_norm.bedgraph| awk '$4 >= 50' > roX2_OE_check.bed

intersectBed -a ./GFP_OE_peaks.narrowPeak -b ./GFP_OE_check.bed -wa |sort | uniq > GFP_OE.filteredPeak
intersectBed -a ./roX2_OE_peaks.narrowPeak -b ./roX2_OE_check.bed -wa |sort | uniq > roX2_OE.filteredPeak

diff peak by macs

macs3 bdgdiff --t1 ./GFP_OE_treat_pileup.bdg --c1 ./GFP_OE_control_lambda.bdg --t2 ./roX2_OE_treat_pileup.bdg --c2 ./roX2_OE_control_lambda.bdg --o-prefix diffpeak

INFO  @ 13 Nov 2025 15:30:27: [43 MB] Read and build treatment 1 bedGraph... 
INFO  @ 13 Nov 2025 15:30:40: [134 MB] Read and build control 1 bedGraph... 
INFO  @ 13 Nov 2025 15:30:56: [251 MB] Read and build treatment 2 bedGraph... 
INFO  @ 13 Nov 2025 15:30:58: [262 MB] Read and build control 2 bedGraph... 
INFO  @ 13 Nov 2025 15:31:49: [858 MB] Write peaks... 
INFO  @ 13 Nov 2025 15:31:49: [858 MB] Done

intersectBed -a ./diffpeak_c3.0_cond1.bed -b ./GFP_OE_check.bed -wa |sort |uniq > GFP_OE_high.filteredPeak
intersectBed -a ./diffpeak_c3.0_cond2.bed -b ./roX2_OE_check.bed -wa |sort |uniq > roX2_OE_high.filteredPeak

annotatePeaks.pl ./GFP_OE_high.filteredPeak mm10 > GFP_high.csv
annotatePeaks.pl ./roX2_OE_high.filteredPeak mm10 > roX2_high.csv

	Peak file = ./GFP_OE_high.filteredPeak
	Genome = mm10
	Organism = mouse
	Peak/BED file conversion summary:
		BED/Header formatted lines: 7154
		peakfile formatted lines: 0
		Duplicated Peak IDs: 0

	Peak File Statistics:
		Total Peaks: 7154
		Redundant Peak IDs: 0
		Peaks lacking information: 0 (need at least 5 columns per peak)
		Peaks with misformatted coordinates: 0 (should be integer)
		Peaks with misformatted strand: 0 (should be either +/- or 0/1)

	Peak file looks good!

	Reading Positions...
	-----------------------
	offset=0
	Finding Closest TSS...
	Annotating:...
		Annotation	Number of peaks	Total size (bp)	Log2 Ratio (obs/exp)	LogP enrichment (+values depleted)
		3UTR	4.0	2261924	-0.814	1.776
		miRNA	0.0	1572	-0.007	0.005
		ncRNA	0.0	440273	-1.245	1.369
		TTS	17.0	3209804	0.769	-3.647
		pseudo	1.0	112683	1.513	-1.219
		Exon	12.0	3597618	0.102	-0.815
		Intron	210.0	104460498	-0.629	32.352
		Intergenic	1043.0	299951322	0.162	-27.584
		Promoter	11.0	3534405	0.002	-0.618
		5UTR	1.0	295082	0.125	-0.510
	NOTE: If this part takes more than 2 minutes, there is a good chance
		your machine ran out of memory: consider hitting ctrl+C and rerunning
		the command with "-noann"
	To capture annotation stats in a file, use "-annStats <filename>" next time
	Annotating:...
		Annotation	Number of peaks	Total size (bp)	Log2 Ratio (obs/exp)	LogP enrichment (+values depleted)
		3UTR	4.0	2261924	-0.813	1.773
		Other	2.0	1955102	-1.603	2.842
		RC?	0.0	1630	-0.007	0.005
		RNA	0.0	14251	-0.063	0.044
		miRNA	0.0	1572	-0.007	0.005
		ncRNA	0.0	440273	-1.244	1.369
		TTS	17.0	3209804	0.769	-3.651
		LINE	335.0	111932786	-0.054	1.507
		LINE?	0.0	676	-0.003	0.002
		srpRNA	0.0	5924	-0.026	0.018
		SINE	77.0	25041054	-0.015	0.708
		RC	0.0	8253	-0.037	0.026
		tRNA	0.0	32296	-0.138	0.100
		DNA?	0.0	17074	-0.075	0.053
		pseudo	1.0	112683	1.514	-1.219
		DNA	17.0	3488124	0.650	-3.007
		Exon	12.0	3597618	0.102	-0.816
		Intron	124.0	61231934	-0.618	17.457
		Intergenic	506.0	128425146	0.343	-22.457
		Promoter	11.0	3534405	0.002	-0.619
		5UTR	1.0	295082	0.125	-0.510
		LTR?	0.0	25957	-0.112	0.081
		scRNA	0.0	99626	-0.389	0.310
		CpG-Island	0.0	344607	-1.051	1.071
		Low_complexity	5.0	2951732	-0.875	2.255
		LTR	175.0	58417076	-0.053	1.145
		Simple_repeat	11.0	8091972	-1.193	6.725
		snRNA	0.0	32747	-0.140	0.102
		Unknown	1.0	1294779	-2.008	2.413
		SINE?	0.0	4205	-0.019	0.013
		Satellite	0.0	1200921	-2.245	3.737
		rRNA	0.0	24604	-0.106	0.076
	Counting Tags in Peaks from each directory...
	Organism: mouse
	Loading Gene Informaiton...
	Outputing Annotation File...
	Done annotating peaks file


	Peak file = ./roX2_OE_high.filteredPeak
	Genome = mm10
	Organism = mouse
	Peak/BED file conversion summary:
		BED/Header formatted lines: 2
		peakfile formatted lines: 0
		Duplicated Peak IDs: 0

	Peak File Statistics:
		Total Peaks: 2
		Redundant Peak IDs: 0
		Peaks lacking information: 0 (need at least 5 columns per peak)
		Peaks with misformatted coordinates: 0 (should be integer)
		Peaks with misformatted strand: 0 (should be either +/- or 0/1)

	Peak file looks good!

	Reading Positions...
	-----------------------
	offset=0
	Finding Closest TSS...
	Annotating:.
		Annotation	Number of peaks	Total size (bp)	Log2 Ratio (obs/exp)	LogP enrichment (+values depleted)
		3UTR	0.0	912091	-0.008	0.005
		miRNA	0.0	1565	-0.000	0.000
		ncRNA	0.0	176408	-0.001	0.001
		TTS	0.0	1271936	-0.011	0.007
		pseudo	0.0	49137	-0.000	0.000
		Exon	0.0	1345645	-0.011	0.008
		Intron	0.0	42814874	-0.417	0.289
		Intergenic	1.0	122614479	0.477	-0.331
		Promoter	0.0	1381821	-0.012	0.008
		5UTR	0.0	113196	-0.001	0.001
	NOTE: If this part takes more than 2 minutes, there is a good chance
		your machine ran out of memory: consider hitting ctrl+C and rerunning
		the command with "-noann"
	To capture annotation stats in a file, use "-annStats <filename>" next time
	Annotating:.
		Annotation	Number of peaks	Total size (bp)	Log2 Ratio (obs/exp)	LogP enrichment (+values depleted)
		3UTR	0.0	912091	-0.008	0.005
		Other	0.0	680155	-0.006	0.004
		RC?	0.0	551	-0.000	0.000
		RNA	0.0	7041	-0.000	0.000
		miRNA	0.0	1565	-0.000	0.000
		ncRNA	0.0	176408	-0.001	0.001
		TTS	0.0	1271936	-0.011	0.007
		LINE	0.0	58384850	-0.603	0.418
		LINE?	0.0	252	-0.000	0.000
		srpRNA	0.0	2237	-0.000	0.000
		SINE	0.0	9603004	-0.083	0.058
		RC	0.0	3592	-0.000	0.000
		tRNA	0.0	16844	-0.000	0.000
		DNA?	0.0	9487	-0.000	0.000
		pseudo	0.0	49137	-0.000	0.000
		DNA	0.0	1615643	-0.014	0.009
		Exon	0.0	1345645	-0.011	0.008
		Intron	0.0	23504225	-0.213	0.148
		Intergenic	1.0	46586251	1.875	-1.300
		Promoter	0.0	1381821	-0.012	0.008
		5UTR	0.0	113196	-0.001	0.001
		LTR?	0.0	13679	-0.000	0.000
		scRNA	0.0	35595	-0.000	0.000
		CpG-Island	0.0	100760	-0.001	0.001
		Low_complexity	0.0	1019307	-0.009	0.006
		LTR	0.0	21103798	-0.190	0.132
		Simple_repeat	0.0	2623670	-0.022	0.015
		snRNA	0.0	16730	-0.000	0.000
		Unknown	0.0	89653	-0.001	0.001
		SINE?	0.0	1305	-0.000	0.000
		Satellite	0.0	199408	-0.002	0.001
		rRNA	0.0	17021	-0.000	0.000
	Counting Tags in Peaks from each directory...
	Organism: mouse
	Loading Gene Informaiton...
	Outputing Annotation File...
	Done annotating peaks file

package Version

echo `fastp --version`
echo `bowtie2 --version`
echo `samtools --version`
echo `sambamba --version`
echo `bedtools --version`
echo `fastqc --version`
echo `multiqc --version`
echo `macs3 --version`
echo `deeptools --version`
echo `homer --version`

fastp 0.23.4

/home/yhli/miniconda3/bin/bowtie2-align-s version 2.5.4 64-bit Built on fv-az356-861 Tue Jun 11 00:21:46 UTC 2024 Compiler: gcc version 12.3.0 (conda-forge gcc 12.3.0-7) Options: -O3 -msse2 -funroll-loops -g3 -fvisibility-inlines-hidden -fmessage-length=0 -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -isystem /home/yhli/miniconda3/include -fdebug-prefix-map=/opt/conda/conda-bld/bowtie2_1718065018344/work=/usr/local/src/conda/bowtie2-2.5.4 -fdebug-prefix-map=/home/yhli/miniconda3=/usr/local/src/conda-prefix -O3 Sizeof {int, long, long long, void*, size_t, off_t}: {4, 8, 8, 8, 8, 8}
samtools 1.20 Using htslib 1.20 Copyright (C) 2024 Genome Research Ltd. Samtools compilation details: Features: build=configure curses=yes CC: /opt/conda/conda-bld/samtools_1720645213030/_build_env/bin/x86_64-conda-linux-gnu-cc CPPFLAGS: -DNDEBUG -D_FORTIFY_SOURCE=2 -O2 -isystem /home/yhli/miniconda3/include CFLAGS: -Wall -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -isystem /home/yhli/miniconda3/include -fdebug-prefix-map=/opt/conda/conda-bld/samtools_1720645213030/work=/usr/local/src/conda/samtools-1.20 -fdebug-prefix-map=/home/yhli/miniconda3=/usr/local/src/conda-prefix LDFLAGS: -Wl,-O2 -Wl,--sort-common -Wl,--as-needed -Wl,-z,relro -Wl,-z,now -Wl,--disable-new-dtags -Wl,--gc-sections -Wl,--allow-shlib-undefined -Wl,-rpath,/home/yhli/miniconda3/lib -Wl,-rpath-link,/home/yhli/miniconda3/lib -L/home/yhli/miniconda3/lib HTSDIR: LIBS: CURSES_LIB: -ltinfow -lncursesw HTSlib compilation details: Features: build=configure libcurl=yes S3=yes GCS=yes libdeflate=yes lzma=yes bzip2=yes plugins=yes plugin-path=/home/yhli/miniconda3/libexec/htslib htscodecs=1.6.0 CC: /opt/conda/conda-bld/htslib_1720639468368/_build_env/bin/x86_64-conda-linux-gnu-cc CPPFLAGS: -DNDEBUG -D_FORTIFY_SOURCE=2 -O2 -isystem /home/yhli/miniconda3/include CFLAGS: -Wall -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -isystem /home/yhli/miniconda3/include -fdebug-prefix-map=/opt/conda/conda-bld/htslib_1720639468368/work=/usr/local/src/conda/htslib-1.20 -fdebug-prefix-map=/home/yhli/miniconda3=/usr/local/src/conda-prefix -fvisibility=hidden LDFLAGS: -Wl,-O2 -Wl,--sort-common -Wl,--as-needed -Wl,-z,relro -Wl,-z,now -Wl,--disable-new-dtags -Wl,--gc-sections -Wl,--allow-shlib-undefined -Wl,-rpath,/home/yhli/miniconda3/lib -Wl,-rpath-link,/home/yhli/miniconda3/lib -L/home/yhli/miniconda3/lib -fvisibility=hidden -rdynamic HTSlib URL scheme handlers present: built-in: preload, data, file libcurl: imaps, pop3, gophers, http, smb, gopher, sftp, ftps, imap, smtp, wss, ws, smtps, rtsp, scp, ftp, telnet, mqtt, https, smbs, tftp, pop3s, dict Google Cloud Storage: gs+http, gs+https, gs Amazon S3: s3+https, s3+http, s3 S3 Multipart Upload: s3w, s3w+https, s3w+http crypt4gh-needed: crypt4gh mem: mem

sambamba 1.0.1
 by Artem Tarasov and Pjotr Prins (C) 2012-2023
    LDC 1.38.0 / DMD v2.108.1 / LLVM17.0.6 / bootstrap LDC - the LLVM D compiler (1.38.0)


sambamba 1.0.1
 by Artem Tarasov and Pjotr Prins (C) 2012-2023
    LDC 1.38.0 / DMD v2.108.1 / LLVM17.0.6 / bootstrap LDC - the LLVM D compiler (1.38.0)


bedtools v2.31.1
FastQC v0.12.1
multiqc, version 1.17
macs3 3.0.2
deeptools 3.5.5
homer : Empirical Motif Optimizer
usage: ./homer [data] [parameters] -a [action]
This program is meant to be called from other programs (i.e. findMotifsGenome.pl), and not used directly
Data options:
	-dna|-prot : Sequence type (-dna)
	-s <file> : Sequence File
	-g <file> : Group/Stat File
	-mer <file> : Mer File
	-m <file> : PSSM Motif File
	-o <file> : output file prefix
	-seed <file> : seed file
	-offset <#> : offset of sequence from TSS (-2000)
Parameter options:
	-exact : remember mapping between mers and genes (default: approx)
	-w : Weight sequences (according to addition columns in group file: 1st-gene 2nd-sequence)
	-T : Test all sequences as candidate motifs (default: only test target sequences)
	-noautoscale : Do not autoscale sequences to be equal in foreground and background
	-freqAdjust : Compute log-odds using frequency, default (0.25)
	-dual : find dual motifs in the form A<gap>B where A and B can be rev-opposites
	-flip : find dual motifs in the form A<gap>B or B<gap>A
	-zoopsapprox <OFF,#(max to count)> : (counts multiple motifs per sequence | default: 2)
	-norevopp : don't search opposite strand (default->DNA:yes, Protein:no)
	-min <#> : min mer size (6)
	-max <#> : max mer size [also standard mer size] (10)
	-len <#> : Find motifs of length # (default=10)
	-gap <#,#,#-#> : Find motifs with gaps(0)(i.e. -gap 3 -gap 2,4,5 -gap 1-10
	    Gaps will only be in the center of motif and will only use even lengthed motifs
	-mis <#> : # of mismatches to check for degeneracy (1)
	-IUPAC <#> : # of IUPAC codes per mer that can be used during global optimization (0)
	-iupactype <1,2,or3> : Type of IUPAC symbols used
		1: (default) Only N is used
		2: Only N and 2 bp symbols are used (i.e. R = A or G
		3: Full IUPAC code is used (includes 3-way symbols)
	-S <#> : number of seeds to check during profile optimization(50)
	-branch <#> : sets depth of optimization (closer to zero the more sensitive (0.5))
	-I <#> : maximum number of iterations during optimization (5)
	-rmalign : DO NOT remove aligned seeds
	-maxneg <0 to 1> maximum percentage of negative genes that can contain the motif
	-speed <NORMAL|FAST>: Program will heuristically avoid performing exhaustive
	    calculations (default: FAST)
Scoring Functions:
	-alg <method> : scoring algorithm (default: hypergeo)
	    hypergeo - hypergeometric scoring (ZOOPS)
	    binomial - binomical scoring [for variable length seq] (ZOOPS) (requires exact)
	    approxbinomial - binomical scoring [for variable length seq] (ZOOPS) (requires exact)
	    sitehypergeo - hypergeometric scoring across seq positions (very slow)
	    sitebinomial - binomial scoring across seq positions
	    fisher <#> - fisher exact test (slow, # scales exponentially)
	      <# = largest repetition to consider [default=2]>
	    rank - group file must have sortable numeric value
	    freqdiff - used by most bayesian/nnet programs
	    logit - used by most bayesian/nnet programs
Background Modeling options (this forces a binomial style scoring function):
	-b <method> [method options...]
	    markov <#> - generate hmm from target sequences using a hmm of order #
	    bmarkov <#> - generate hmm from background sequences using a hmm of order #
	    mosaic - generate mosaic hmm from background sequences **coming soon**
Filter Options:
	-N <float> : filtering cutoff for ratio of N's in sequence (0.9)
	-seqless <#> : filter sequences shorter than #
	-seqmore <#> : filter sequences longer than #
Actions (-a):
	MOTIFS - Find motifs <outfile>.motifs# where # = motif length
	MERS - Create mer file (low memory) <stdout>
	DMERS - Create degenerate mer file <stdout>
	FIND - find motifs in sequence <stdout>
	OPTPVALUE - optimize motif threshold and pvalue (exact)<stdout>
	GETPVALUE - get the p-value enrichment for a given motif(exact)<stdout>
	GENESCORE - returns highest motif score for each gene <stdout>
	REFINE - optimize motif PSSM profile, threshold, and pvalue <stdout>
	REFINETHRESH - optimize motif PSSM threshold and pvalue <stdout>
	CLUSTER - cluster mers from seed file (can't use exact scoring) <outfile>
	SORTMERS - sort a mer file according to pvalue <stdout>
	REMOVE - removes motif from sequence (replaces with N's) <stdout>

This program is meant to be called from other programs (i.e. findMotifsGenome.pl), and not used directly

Citations

fastp

Shifu Chen. 2023. Ultrafast one-pass FASTQ data preprocessing, quality control, and deduplication using fastp. iMeta 2: e107. https://doi.org/10.1002/imt2.107

Shifu Chen, Yanqing Zhou, Yaru Chen, Jia Gu; fastp: an ultra-fast all-in-one FASTQ preprocessor, Bioinformatics, Volume 34, Issue 17, 1 September 2018, Pages i884–i890, https://doi.org/10.1093/bioinformatics/bty560

multiqc

Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016;32(19):3047-3048. doi:10.1093/bioinformatics/btw354

bowtie2

Langmead, B., Salzberg, S. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359 (2012). https://doi.org/10.1038/nmeth.1923

samtools

Li H, Handsaker B, Wysoker A, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25(16):2078-2079. doi:10.1093/bioinformatics/btp352

sambamba

Tarasov A, Vilella AJ, Cuppen E, Nijman IJ, Prins P. Sambamba: fast processing of NGS alignment formats. Bioinformatics. 2015;31(12):2032-2034. doi:10.1093/bioinformatics/btv098

bedtools

Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010;26(6):841-842. doi:10.1093/bioinformatics/btq033

hg38-blacklist.v2

Amemiya, H.M., Kundaje, A. & Boyle, A.P. The ENCODE Blacklist: Identification of Problematic Regions of the Genome. Sci Rep 9, 9354 (2019). https://doi.org/10.1038/s41598-019-45839-z

macs3

Zhang, Y., Liu, T., Meyer, C.A. et al. Model-based Analysis of ChIP-Seq (MACS). Genome Biol 9, R137 (2008). https://doi.org/10.1186/gb-2008-9-9-r137

deeptools

Ramírez F, Ryan DP, Grüning B, et al. deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 2016;44(W1):W160-W165. doi:10.1093/nar/gkw257

meme Suite

Bailey TL, Johnson J, Grant CE, Noble WS. The MEME Suite. Nucleic Acids Res. 2015;43(W1):W39-W49. doi:10.1093/nar/gkv416

WashU Epigenome browser

Li D, Purushotham D, Harrison JK, et al. WashU Epigenome Browser update 2022. Nucleic Acids Res. 2022;50(W1):W774-W781. doi:10.1093/nar/gkac238

https://epigenomegateway.wustl.edu/browser/